MG_091 – single-strand binding protein family

Name
WID MG_091 View in model
Name single-strand binding protein family View in model
Protein product MG_091_MONOMER
Cross references GenBank: AAC71309.1, CMR: MG_091, BioCyc: MG_091, SwissProt: P47337
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 115053120536 MG_089 MG_090 MG_091 MG_092 MG_093 MG_094 MG_095 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 117553 (nt), Length: 483 (nt), Direction: Forward, G/C content: 34.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGAACCGGGTCTTCTTGTTTGGTAAACTCAGTTTTACTCCCAACCGTTT
ACAGACAAAAAATGGTACGTTAGGAGCTACTTTTTCCATGGAATGTCTTG
ATTCCAGTGGTTTTAATAATGCCAAATCATTCATTAGAGTAACTGCTTGA
GGTAAAGTTGCTAGTTTTATTGTTGCTCAAAATCCTGGGGTGATGCTTTT
TGTAGAAGGAAGATTAACTACATATAAAATTACTAACAGTGAAAATAAAA
ACACCTATGCTTTACAAGTAACTGCTGATAAGATCTTTCATCCTGATGAA
AAAACTACCAATGAAGAACCTATTAAATCAACTGTAGTTGATTCACCCTT
TATGAATCCCAAAGCAAGTGTTACAGAAGCTGAGTTTGAACAAGCATTCC
CCCATCAAGATGAAACTGATTTTAACAACATTACCCCTATATTTGAAAAT
GATGTCCAACTAGAGGAGGAAAGTGATGATTAA
50
100
150
200
250
300
350
400
450
483
View in model
Transcription unit TU_057 View in model
Empirical formula (pH 7.5) H5165C4681N1968O3365P483
Molecular weight (pH 7.5; Da) 157791.40 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
6.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4928700
pI 3.92
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:13
Last updated 2012-10-01 15:12:51