MG_090 – ribosomal protein S6

Name
WID MG_090 View in model
Name ribosomal protein S6 View in model
Symbol rpsF
Protein product MG_090_MONOMER
Cross references GenBank: AAC71308.1, CMR: MG_090, BioCyc: MG_090, SwissProt: P47336
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 114426120053 MG_088 MG_089 MG_090 MG_091 MG_092 MG_093 MG_094 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 116926 (nt), Length: 627 (nt), Direction: Forward, G/C content: 34.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGCACTACAATATCATTCTTTTAGTTGATGGTACGCTTAGTTTAGAACA
AGCTAACCAAGTTGAACAAAAACACCAAAAATTGCTTGAAAAGGCAACTG
AATTTAAAAGTGAATACTTAGGTTTAAAAGAGTTGGCTTACCCCATTAAA
AAGCAACTTTCTGCTCACTATTACAGATGGAGTTTTCATGGTGAAAGCAA
TTGTACTAAGGAGTTTAAAAGAGCTGCTAACATCAATAAGCAGATAATAA
GAGAGTTAATTATTAACAGAGAAAAAGACTATGGTTATTTAGGTTCAGTT
AACCCTAAAAAACAACAACTGTCTTTGCAGAAGCTAACCAAGTATAATGA
GATTATTGCTAGTGAAAATAATCCTGATAACCCAGATGCGCCTGTCACTT
CTGGTCTAGCTTCTGTTAAACCACGGCTATCAAGAGTTGAAAAACAAAAG
GAACGTGAACTTGAAAAGTGAACGGTTGTTCACCAATCAGGTAACTTTGA
TACTGTACAGATCAATCCTTATCGTCCTAGGATAAAACGCTTTTTACAAA
ACAACCAACAAACCTCCCAAGCTAATAATAACCAACCTCGTTTTCAAAAT
CAATTTAAAAAAGGAGCAAAACCTTAG
50
100
150
200
250
300
350
400
450
500
550
600
627
View in model
Transcription unit TU_056 View in model
Empirical formula (pH 7.5) H6729C6101N2628O4317P627
Molecular weight (pH 7.5; Da) 205359.03 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
6.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6457800
pI 3.66
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:13
Last updated 2012-10-01 15:12:51