MG_087 – ribosomal protein S12

Name
WID MG_087 View in model
Name ribosomal protein S12 View in model
Symbol rpsL
Protein product MG_087_MONOMER
Cross references GenBank: AAC71305.1, CMR: MG_087, BioCyc: MG_087, SwissProt: P47333
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 111395116815 MG_084 MG_085 MG_086 MG_087 MG_088 MG_089 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 113895 (nt), Length: 420 (nt), Direction: Forward, G/C content: 38.6%, Sequence:
1
51
101
151
201
251
301
351
401
ATGGCTACAATAGCGCAATTAATTAGAAAACCACGCCAAAAAAAGAAGGT
TAAATCAAAGTCACCTGCACTCCATTATAACCTCAACCTTTTAAACAAAA
AAACTACCAATGTTTACTCACCACTAAAGCGTGGTGTTTGCACCAGGGTT
GGCACCATGACCCCCAGAAAACCTAATTCTGCACTAAGAAAGTATGCTAA
GGTTAGACTTACAAATGGCTTTGAAGTACTTGCTTATATCCCAGGAGAAG
GTCATAACCTACAAGAACACAGTGTTACTTTATTAAGGGGGGGTAGAGTA
AAAGATCTCCCTGGAGTTAGATACCATATTGTTCGTGGTACTTTAGATAC
AGTTGGTGTTGACAAAAGAAGACAACAACGTTCTGCATATGGCGCTAAAA
AACCAAAACCAAAATCTTAA
50
100
150
200
250
300
350
400
420
View in model
Transcription unit TU_055 View in model
Empirical formula (pH 7.5) H4518C4097N1791O2889P420
Molecular weight (pH 7.5; Da) 138078.79 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
8.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4272700
pI 3.60
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:13
Last updated 2012-10-01 15:12:50