MG_085 – HPr(Ser) kinase/phosphatase

Name
WID MG_085 View in model
Name HPr(Ser) kinase/phosphatase View in model
Symbol hprK
Protein product MG_085_MONOMER
Cross references GenBank: AAC71303.1, CMR: MG_085, BioCyc: MG_085, SwissProt: P47331
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 109290115226 MG_081 MG_082 MG_083 MG_084 MG_085 MG_086 MG_087 MG_088 MG_089 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 111790 (nt), Length: 936 (nt), Direction: Forward, G/C content: 32.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
ATGAAACATTTAACTGTCAAAGCATTAGTTTTGCAATTTAATGATTGTAT
CCAACTCATTGATGGTAAAAACAACATAGATAATGTGATTACTATCCCTG
GGTTAAAAAGGAGTGTTTTTGAACTATTAGGACTATTTTGTAAGCCAATT
GGTTCAGTTGCTATTTTAGGTAAACGTGAATTTATTTTTTTAAATCAAAA
GCCAGTTGAGCAACAGAAAAAGATTATTGCAAACCTCTTGAAACTCAAAC
CACCTGCAGTTATTCTAACCAAGTCATTTCTTGATTGTGGTGTTTTGTTA
GCTGTTAATCAAACTTATCAAGTTCCTATTTTAAAAACTAACTTGTTTTC
AACTGAACTCTCTTTTACTGTTGAAACCTATATTAACGAGCAATTTGCTA
CTGTTCAAAAGTTACATGGGGTTTTACTTGAAATCTTTGGTGTTGGGGTA
TTTTTAGAAGGAAAGAGTGGGATTGGTAAATCTGAAAGTGCTTTAGATTT
AATTAATAAAAACCACCTTCTAATAGGTGATGATGCTATTGAGATCTACA
GATTAGGCAATAGGTTATTTGGTAGAGCACAAGCACTGGCAAAAGGCTTT
ATGGAGATTAGAGGTCTTGGCATCATTAATATTGAACGTGCTTATGGGTT
ACAGATTACAAAAGAACAAACTGAAATCCAACTAGCAATTAGTTTGTTGA
GTTTAGAGGAGAAAAACAACGCTAGTTTTGAGCGCTTAGGCAGTGATTTA
AAACTAAAAAATCTGCTTGGGGTTAAGATTAGTTACTATCAGATCCCTAT
CTCTTCAGGTAGAAAAACAAGCGAAATTATTGAAAGTGCAGTAATCGATT
TTAAACTTAAGAAAAGTGGTTACAATTCAGCAAACGAGTTTATCTTAAAG
CAACGTGCCATGTTAGAAGAACAAACTGATGAATAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
936
View in model
Transcription unit TU_054 View in model
Empirical formula (pH 7.5) H9990C9053N3759O6539P936
Molecular weight (pH 7.5; Da) 305064.53 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9678300
pI 4.07
 
Comments
Comments Regulates HPr (PtsH, MG_041_MONOMER) by phosphorylating the protein. Phosphorylated HPr in turn senses glycolytic intermediates such as FDP and regulates carbon catabolite repression. Specifically HPr activates CcpA which in turn represses the transcription of metabolic genes and enhances the transcription of glycolytic genes [PUB_0442].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Brochu D, Vadeboncoeur C. The HPr(Ser) kinase of Streptococcus salivarius: purification, properties, and cloning of the hprK gene. J Bacteriol 181, 709-17 (1999). WholeCell: PUB_0442, PubMed: 9922231

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:13
Last updated 2012-10-01 15:12:50