MG_082 – ribosomal protein L1

Name
WID MG_082 View in model
Name ribosomal protein L1 View in model
Symbol rplA
Protein product MG_082_MONOMER
Cross references GenBank: AAC71300.1, CMR: MG_082, BioCyc: MG_082, SwissProt: P47328
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 107175112856 MG_080 MG_081 MG_082 MG_083 MG_084 MG_085 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 109675 (nt), Length: 681 (nt), Direction: Forward, G/C content: 33.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGAAAAAACTATCAAAAAGGATGCAAGCTGTTACCAAGCTCATTGATAA
AAACAAACTTTATCCTATCCAAGAAGCATTTGAATTAATTAAAAAAACAG
CAATTACTAAGTTTGTCAGTTCAGTTGATATTGCTGTTAGTTTAAACCTT
GATACTACTAAAGCTGAACAACAGTTAAGAGGTGCAATTGCTTTTCCTTT
TAGTATTGGTAAATCTATCAGAATTTTAGCTATCACTGATGATGAGAAAA
AAGCTAGTGAAGCAGGTGCTGATTTTGTTGGTGGGCTTGATAAGATAGAA
GCGATAAAAAATGGCTGATTAGATTTTGATCTAATTATCACTTCTCCCAA
GTTCATGGGAGCATTAGGTAAACTAGGAAAACTATTAGGAACCAGGGGAT
TGATGCCAAACCCAAAAACTGAAACAGTTACTGATGATGTAGTTAGTGCT
ATTAAAGCTTATAAAAAGGGTAAGAAAGAATATCGAACTGATTCATTTGG
CAACATCCACCTCTCTTTAGGTAAAACAGATACCAAAACTGAGCACTTGG
TTGCTAATGCCATGGCTTTAATAGATTTAATTAAGTCTAAACGTCCTAGC
ACAGTCAAAGGTACTTACATTAAAAATATTGCTTTGACAACAACAATGGG
ACCAAGTTTAAAAGTAAAGCTACCTGATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
681
View in model
Transcription unit TU_052 View in model
Empirical formula (pH 7.5) H7293C6611N2808O4714P681
Molecular weight (pH 7.5; Da) 222598.50 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
3.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7043900
pI 3.80
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:13
Last updated 2012-10-01 15:12:50