MG_075 – 116 kDa surface antigen

Name
WID MG_075 View in model
Name 116 kDa surface antigen View in model
Protein product MG_075_MONOMER
Cross references GenBank: AAC71293.1, CMR: MG_075, BioCyc: MG_075, SwissProt: P47321
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 96883104958 MG_073 MG_075 MG_077 MG_078 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 99383 (nt), Length: 3075 (nt), Direction: Forward, G/C content: 30.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
2151
2201
2251
2301
2351
2401
2451
2501
2551
2601
2651
2701
2751
2801
2851
2901
2951
3001
3051
ATGAAATTAAGTACAATAACTACTATCTGCTTGTCAATATCTGGTGCTTT
TGGTACTACTGCAATTGCTTTACCAACTACAGTAGCATTGTTAAAAAACC
ACCAACAGCAAAACACTGAAAAACAACAAAACCCGATTAAAGATATCCGC
TTTGGTTTAAACAATGTACAGGTTCCAAATACCATTCCGTTACACCAAAC
TGTGGTTGAAGTGACCAACAACAAAGCAATTGTTGATTACAAAGATGCAC
CCCAAAAATTCTTTTTAGCTAAAAGTGCGTTAAATAATAAACTCCAAGTT
GAGTTTGATAAGTTCTTGTTAAGAACAGGAGTGATTAATGCTTTAAATGC
AGATTTGAAAGAATGGATAGACCAAACATTATTTATCCCCAATCAAAGTT
TTTTTGATCTTAGTGCTAATAAACTCAATTTAACTTTGTCAAATCAAAGC
GAAGTGAGTTTAGATCTTGAGTTTATTTTTACTAACTTTAGTGATAAAAA
TCAACCATTAAAACTCCCCTTTGATGGTAGTGTGGTGGTTAATGCTAACG
AGTCATACACCTATTCAGTTAAAGCAACACTACAGAAACTAAAAGTATTG
ACTTATTCAAGAGCAGATCATTCTGTAGGGATTAGTTATGCAATACCAAC
AGTGAGTTTAAATGGCAAAACTCAAAATGACTTTAGTTTTAACCCCTTTA
AAAGTAATATTAACTTTGCTTTCAAAAATGTCTACAATGCTTTAAATCCG
TTTGAAGCACAACAATACCTGGTTGGCCAAGGTAAGTTTTTAAACCAAAA
AGTTAATGCTGATGATGTTAAAAATGACATTAATAATCACATTGAAACCC
AGTTTAATGTTGCTAAAATCACAGCAACTCTTTTAGGAAAAGCTTTTAAG
CAGTTTGGTGAACATAAAAATGGTCAACCACTTTCACTTTTAAAAGTACT
AAGTGGATTAAACAATGAGTTTAAACAACTCTTTAATTATGTCAGACCTG
GTTTAGGTGATTTTGTTAGTGATTTAATCCAAAGCTCCAGTCAATCAAGT
AATAAAAAAACTGTTTACCAGCTATTATTTGAAAACAAGACAACAATTAT
CCACTTGTTGCAAGATCTTAATATTAGTGAACTGAACTCTGTTTTACCAG
TTGTTGATATTTTGTTTGAAGGGATTAACAGTGCAGAATCACTATACCAA
AGGATCCAATCATTTAAGGATTTAATTGTTCCTGCTTTAAAAGCTGATAA
GCAACTTAAGAGCTTAGAAGCGATTATTTTAGCAGTTTTAGACAATCCTA
ATACCTATGTTTTTGATCTTGTTTACCAAAACAAATCGATTCTGTTTAAT
TTGTTAAGTGATTTTCTTAAAAACACCGCAAACACTTTACCATTTCTTCA
AGAACAGTTTGATATTGTTAACCACTTATTTGCCAATGAAGCGATCTTTG
ATCTGTTTTCCAATGCTGACTTTGTTGAGAAGATTGCTGATCTTTTTTTA
GCAAAACAAAAGGTACAAGAAGTTAATAATGATGGAACTAAATCAACAAA
AATTGTTGATTCGATTTTAGTTGCTACCCTTAAGGGTTTAGTTGGTGATC
AGCTCAGTTCAATCACTGAACTGTTAAACATCTATATCTTTGAAAATGAA
TTTTTAAACAGAAATGATAGTAATAGTTCAGTTAAAAAACAACAAACTGA
TAGTCTAAAAAATCTGTTTAGCGTAATTGGTGATATTTTAAGTGAGACCA
ATGTTAACAAGATCACTTTACACGCAGTTAAAAATAATGAACTTCTTTCG
TTAGTTGAAACAGCTTCAACACTAAAAATTAAACATCTTAATGTTCAATA
CAAAGTTTTAGTTGATAAGTTTGAATTGAAAAACAGTTTCATTAAGGAAC
TATTAAATTTTTTCCCAGATACTAAAGATATCACCCCAACTATTAAAAAG
GTACTGTTTGAAAGTGAAAATTATAAAACACTCCGTAAGAAGTATGAAAA
TGAAGGGTTCCCAGGTTATCACTGGGCTAAGTTCATTGTCCCAGGTACCT
TCAATTCTGCTGAAAACACTTTCTATTCTGCTATTGATAAAACTAAATCA
ATTCGCGATCTGTTTGCTGACATGTTATTTGGTAAGAGTTTAGAGAGTGT
TAATGACAGTGATAGTTTTATCAAAATTAATGGTTCATTTACATTAAAGT
ACCACGGTGATAACTTAAATTTACTCCCTAACTACCACTCATTAATCACT
AAGAATGTTGGTTATCAAATAGTTAATGTTAATTTTCATATTGATGCAAG
ATTGCTAACTGCAGAACTACAAAACACGGTATTTTCAAATCCAAAACCAG
TTATTAAATCACCTGTTGAACTCTCCAAATCCTTATTTGAAGTTTGAAAG
ACTATCTTTGAAAACTCAGTTAACCAAATCTTAAAAAAAGAATATACTTT
CAAAGATAATCTAAAGTTCTTTCCTTTTAAAGCTGATGGCTCCTCGCGCT
TAGAATTTGATCTATCAAAACCTGATCAACGTGTTATTCCTTTTGCTTTT
GTTGATGGTTATCAATTCCAACTAAAAAAAGAGTTAATTCCTAACAAAGA
AACAAAAAAAGAAGCTAATTCTTCACCAGTTTTAAAGCTTTATGATGCAG
TTAAAAGAAACGATAGACAATATCGTCCTAATCACCACCATGATGATCTG
AGAAACTATCCTAGCCTTAAATCTCAACTAGAACTTATATTAAACCTTGG
TGATAAGCTTAAAGCTAATAATGATTTTATAGATGACACTGTTGTTAATG
CTTTGCAATATAAAACTAGTTTTAAATCTACTCTAAAAGTTAACAGTTTA
GGAATTCCTATTAACCTTTTCTTTTTCACATTGTGACTTAAATTTAACTT
AGAAATTCCAATTGACGGTTCATTAACATTAACATCCGTTAATGTTGTTT
TCCCATACAGTTTGTATGATACTAGTTCAAATGAATTTACAAGGATAGTC
GATCGCTTAAATTTCACTGATACCAACTTCTATCTAAAAGATGCATTTCC
TAATTTCTGGTTTGTTGGTTTCTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
2050
2100
2150
2200
2250
2300
2350
2400
2450
2500
2550
2600
2650
2700
2750
2800
2850
2900
2950
3000
3050
3075
View in model
Transcription unit TU_049 View in model
Empirical formula (pH 7.5) H32797C29721N12288O21458P3075
Molecular weight (pH 7.5; Da) 1000700.00 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
31708500
pI 4.01
 
Comments
Comments immunoreactive [PUB_0176]; in an operon with MG_074 [PUB_0176]; Suthers et al [PUB_0610] annotates MG_075 as a teichuronic acid synthase. However evidence for this annotation is weak.
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Duffy MF, Walker ID, Browning GF. The immunoreactive 116 kDa surface protein of Mycoplasma pneumoniae is encoded in an operon. Microbiology 143 ( Pt 10), 3391-402 (1997). WholeCell: PUB_0176, PubMed: 9353941

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Suthers PF, Dasika MS, Kumar VS, Denisov G, Glass JI, Maranas CD. A genome-scale metabolic reconstruction of Mycoplasma genitalium, iPS189. PLoS Comput Biol 5, e1000285 (2009). WholeCell: PUB_0610, PubMed: 19214212

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:13
Last updated 2012-10-01 15:12:48