MG_074

Name
WID MG_074 View in model
Protein product MG_074_MONOMER
Cross references GenBank: AAC71292.1, CMR: MG_074, BioCyc: MG_074, SwissProt: P47320
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 96406101820 MG_072 MG_073 MG_074 MG_075 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 98906 (nt), Length: 414 (nt), Direction: Forward, G/C content: 28.5%, Sequence:
1
51
101
151
201
251
301
351
401
ATGCGACAGTTTATTAAGCTTAGCCTCTTAGTCTTTGTCTTGCTTTTCTT
AAGTGAACTTATCTGTAGGTTCTCTTTACGCTTAGTAAATTCTATTAAAG
CGAGATATAAATCTTCAGTATTTTCCTACACTGCTTGTTTGCTATTTTTA
AAGAGTTTTCAAAACTTTTCTAATGCTTTTCAGAAGTTAGCTAACTGGGT
ATTTTGATTTGAAAATGATGTTAATGAACTGTTATCTATCTTTTACTTTA
ACTTTGATCAGAAGAGTGAAAAAGTAGATTACAACTTCTTTAATGGTTAT
AAAGTTACTGCTCAAAAAGTAGTTGAAAAAGAACAGTTATTAACTTGTAA
GTTAAGTGATTACTACCGTTTATTTAGAGATAAAACCTTTTGATTTGAAC
TTATCAACAACTAA
50
100
150
200
250
300
350
400
414
View in model
Transcription unit TU_048 View in model
Empirical formula (pH 7.5) H4389C3974N1572O2935P414
Molecular weight (pH 7.5; Da) 133954.12 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
2.98349 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4235000
pI 4.73
 
Comments
Comments in an operon with MG_075 [PUB_0176];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Duffy MF, Walker ID, Browning GF. The immunoreactive 116 kDa surface protein of Mycoplasma pneumoniae is encoded in an operon. Microbiology 143 ( Pt 10), 3391-402 (1997). WholeCell: PUB_0176, PubMed: 9353941

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:13
Last updated 2012-10-01 15:12:48