MG_060 – glycosyl transferase

Name
WID MG_060 View in model
Name glycosyl transferase View in model
Symbol rfbV
Protein product MG_060_MONOMER
Cross references GenBank: AAC71277.1, CMR: MG_060, BioCyc: MG_060, SwissProt: P47306
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 6515071044 MG_056 MG_057 MG_058 MG_059 MG_060 MG_061 MG_062 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 67650 (nt), Length: 894 (nt), Direction: Forward, G/C content: 27.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGAAATTATCTGTAATTATACCTACTTACAATTGTGCATCATTTATTGA
AAAAGCAATTAATTCAATTGTTAAAAATAGACCTAATGATTTGGAAATAG
AAGTTTTAATTATTGATGATGGATCAATTGACAATACTAACAAAGTTATT
AAGAAAATTCAAGACCAAATTAATAATTTAACTTTGCAGTATTTTTACAA
AAGTAATGGTAACTGGGGTAGTGTTATTAATTATGTTAGAAACAATAAAC
TAGCAAAAGGGGAATGAGTAACAGTATTGGATAGTGATGACATTTTTTCA
AAAAAAACAATTTCTATTTTTCAAAAATATGCCCAAAAACAAAGATATGA
TGCGATTATTTTTGACTACTATAAATGCTGAAAAAAGTTTTTGTGAAAAA
TTCCTACCTATGCAAGGTTTAGAAAAGAAATTAAAGGTGAATTGAAAAAA
CAAACACCTTTTTGTATTCCCTTAGCTAAGTTTTTTAAAAATGAGGTTTT
CTATCAACTTCCTAAACTAAGAGAAAATGTTGGTTTTCAAGACGCTATTT
ATACGATGCATGCATTACAAATTGCAAATAATGTTTTCCATGTTTCTAAA
GCTGGAGGATATTACTTTTTTAAAAGGGTAGGTAACTCTATGAGTATCCC
TTGACACAGTTCTAGGTTTGATATTGAAGTACAAATCTGCAAGGATCTGA
TTGAAAATAATGCGCAAGAGATCGCTTTAGTGCATTTACTTCGTTTAAAA
TTTCGTAATTTAGTTGATGATAAAAAGATTAAATTTACAGTTAAAAGAGA
CTTTTGTTTTAGTGGTTTTAGTTGGTATAGTAGGTTAATTTTATCTCTGA
TGTATAACTTCTGATTGAAACGTTATTTCAACAGTTCTGAATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
894
View in model
Transcription unit TU_035 View in model
Empirical formula (pH 7.5) H9518C8623N3519O6243P894
Molecular weight (pH 7.5; Da) 290025.87 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9381400
pI 4.13
 
Comments
Comments synthesize oligosaccharides, polysaccharides, and glycoconjugates by transferring the sugar moiety from an activated nucleotide-sugar donor to an acceptor molecule, which may be a growing oligosaccharide, a lipid, or a protein, for example (malQ, coli): (glucose)n + (glucose)m (glucose)n+m-1 + alpha-D-glucose [PUB_0110]; essential for O-antigen biosynthesis in V. cholerae [PUB_0237]; group 6 nrd2 glycosyltransferases: abequose transferase, takes part in the formation of the O-antigen repeat unit [PUB_0238];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Fallarino A, Mavrangelos C, Stroeher UH, Manning PA. Identification of additional genes required for O-antigen biosynthesis in Vibrio cholerae O1. J Bacteriol 179, 2147-53 (1997). WholeCell: PUB_0237, PubMed: 9079898

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Kapitonov D, Yu RK. Conserved domains of glycosyltransferases. Glycobiology 9, 961-78 (1999). WholeCell: PUB_0238, PubMed: 10521532

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:12
Last updated 2012-10-01 15:12:46