MG_059 – SsrA-binding protein

Name
WID MG_059 View in model
Name SsrA-binding protein View in model
Symbol smpB
Protein product MG_059_MONOMER
Cross references GenBank: AAC71276.1, CMR: MG_059, BioCyc: MG_059, SwissProt: P47305
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 6470670144 MG_056 MG_057 MG_058 MG_059 MG_060 MG_061 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 67206 (nt), Length: 438 (nt), Direction: Reverse, G/C content: 28.1%, Sequence:
1
51
101
151
201
251
301
351
401
ATGTTAATTCTTGTTAACAATCCTAAGGCTAAATATGACTATCATTTAAT
GGAATCTTATTGTGCTGGAATAGTTTTAAAAGGAAGTGAAGTTAAAGCTT
TAAGTTTAGGTCAAGGTAGTTTAAAAGAAGCTTATGTTTTTGTTAAAAAC
AATGAGCTTTTTTTAGAACAGTTCACTATTCCACCTTATAGTTTTGCAGG
TCCATTAAATCACGCTTCAGATAGAATTAAGAAACTTTTATTAAATAAAC
ATGAAATTAAACAAATTATCAATAAAAAACAACAACAATCTTTATCTGTA
ATCCCAAGTAAAGTATTCTTTAGAAATGGCAAAATTAAAGTGGAAATTTG
ATTGGCAAAACCTAAAAAGAAATTTGACAAACGTGAAACTATTAAAAAGA
AAACAATCCGACGCGAGCTTGAAGCTGAGTATCGATAA
50
100
150
200
250
300
350
400
438
View in model
Transcription unit TU_034 View in model
Empirical formula (pH 7.5) H4681C4242N1776O3028P438
Molecular weight (pH 7.5; Da) 142555.98 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
5.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4591900
pI 3.84
 
Comments
Comments Helps ssrA associate with stalled ribosomes
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:12
Last updated 2012-10-01 15:12:46