MG_057 – small primase-like protein

Name
WID MG_057 View in model
Name small primase-like protein View in model
Protein product MG_057_MONOMER
Cross references GenBank: AAC71274.1, CMR: MG_057, BioCyc: MG_057, SwissProt: P47303
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 6321268749 MG_054 MG_055 MG_056 MG_057 MG_058 MG_059 MG_060 MG_474 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 65712 (nt), Length: 537 (nt), Direction: Reverse, G/C content: 27.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGGATCAAAAAGCACGTATAAAAATTGATGGGGTAATTGTTTGTGAGGG
TAAAACTGACCAAGCTAAATTACAGCAAATTTTTGATGTAGATGTAATTA
CAACAAATGGTTCAGCTTTAAAAAAAGAAACTATTAACCTAATTAAAAAA
ATCAGTGAAAAGCAAACTGTTATCTTGTTATTAGATCCAGATCAACAAGG
CAAAAAGATTAGAAGTAAATTAGAACAACATCTAACAAACTATTACAACT
GTTATGTTGATATGAATGCAAGGTTAAAAAACGCTAAAAAAGCTGGTATT
GCTGAAATGGAAACTAGTGCTTTAATTGCTGCTTTAAATAATCGTGTTGC
AATCACAAAAAATGCTAATCAAAGCATATTATGAGATCAGTATTTAAGCT
TAAAGTTAAATGATAAGAAAAAGCGATTACTTTTATGCAATAATCTTAAT
TTACCTTATTTTAACCACAAGCAACTATTTAAAAAACTTAACTTATTAAA
TCTAACTTTTCAAGATGTATGAAAACACTTAAAGTAG
50
100
150
200
250
300
350
400
450
500
537
View in model
Transcription unit TU_032 View in model
Empirical formula (pH 7.5) H5747C5209N2202O3692P537
Molecular weight (pH 7.5; Da) 174901.61 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5658600
pI 3.73
 
Comments
Comments Contain toprim domain found in bacterial primases [PUB_0202]. Glass manual annotates this gene as ribonuclease MS [PUB_0764].
References
  1. Aravind L, Leipe DD, Koonin EV. Toprim--a conserved catalytic domain in type IA and II topoisomerases, DnaG-type primases, OLD family nucleases and RecR proteins. Nucleic Acids Res 26, 4205-13 (1998). WholeCell: PUB_0202, PubMed: 9722641

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Goetz P. Cell-cycle-regulated expression and subcellular localization of the Caulobacter crescentus SMC chromosome structural protein. (2011). WholeCell: PUB_0764, None

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:12
Last updated 2012-10-01 15:12:46