MG_056 – tetrapyrrole (corrin/porphyrin) methylase protein

Name
WID MG_056 View in model
Name tetrapyrrole (corrin/porphyrin) methylase protein View in model
Symbol yraL
Protein product MG_056_MONOMER
Cross references GenBank: AAC71273.1, CMR: MG_056, BioCyc: MG_056, SwissProt: P47302
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 6239768231 MG_053 MG_054 MG_055 MG_056 MG_057 MG_058 MG_059 MG_060 MG_474 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 64897 (nt), Length: 834 (nt), Direction: Reverse, G/C content: 27.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGAAAACACTTAAAGTAGTTGCTACACCAATTGGTAATATTCAAGAGAT
AAGTGAAAGAGCTAAAAAAGCGTTACAAGATTGTGAAGTGTTATTCTGTG
AAGATAGTAGAGTAACAAGAAAAATGCTGGATTTACTCAACATTGATTGC
AAGCAAAAAAAGTTTGTTATTAACAACAGTTTTAAAGAAAAACAGAATTT
AACTTTTGCTGAGGAATTTATAACTAACTTTAAGTGTTGTCTTGTTAGTG
ATGCAGGTTATCCTAGTTTATCTGATCCTGGTAATGAAATGATTAATTGG
ATCATATCAAAAAATAAGGAGATAAGAATCGAAGTTATTAATGGTCCTAG
TGCATTAATGTGTGGATTGATCACTAGTGGTTTTAAAACAACACCACTTT
TGTTTTTAGGTTTTTTAAGTCACAAACAAAATCAGCTCAAAAATTATTTA
AGTACCTATCAAAATCAGAAAAGCACTATCGTTTTTTTTGAAGCAGTGCA
TAGGTTAGAAAATACTTTAGAAACTGTGAAAAATGTTTTTAAAAACAATG
ACGTTTTTATAGGAAGAGAATTAACTAAGTTACATGAATCACATTATTGA
TTTAACACCAGTGAAAACACTTTACCTGACATCACTTTAAAAGGAGAATT
TGTAATTGTTATTGATAATCAAAATATTAATCACCAAACATTATCTTCCA
ATCAATACTTAGTATATGAAATAAAGAAGTTAATGGATATTGGTGTTAAG
TTAAAAGATGCATGCAATTATTTAGCTAAAAAAATGCATTTAAAATCAAG
TATGCTCTATACACTTTTCCATGAAAGTATTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
834
View in model
Transcription unit TU_032 View in model
Empirical formula (pH 7.5) H8901C8066N3348O5785P834
Molecular weight (pH 7.5; Da) 271132.73 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.9 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8787900
pI 3.93
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:12
Last updated 2012-10-01 15:12:46