MG_055 – preprotein translocase, SecE subunit

Name
WID MG_055 View in model
Name preprotein translocase, SecE subunit View in model
Symbol secE
Protein product MG_055_MONOMER
Cross references GenBank: AAC71271.1, CMR: MG_055, BioCyc: MG_055, SwissProt: P47301
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 6148966861 MG_053 MG_054 MG_055 MG_056 MG_057 MG_058 MG_474 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 63989 (nt), Length: 372 (nt), Direction: Reverse, G/C content: 28.5%, Sequence:
1
51
101
151
201
251
301
351
ATGGAAAAAAAACTGCCTTTTAGCTTTAAAAAGAAGGAAAAGCTAACTGC
TTATGATGATGCTTCAATTCATGAGTTACATAAACAGCTCAAACTTAGAA
CAGAAGCCAAGAAAAGTAAAGATAAGGAAAGAACTAAAGAAAAAGAAAAG
CATGAAAGTTTAGCAAAGGAAAAGAAACCCAAGCTTCCTTTTAAAAAACG
AATTGTTAATTTATGATTTGGAGTTGATAAAGAGATCAACAAAATTGTTT
GAGTAAAAGGTAGACAACTTATCATAATTTTTCTTTTAATTTTGCTAGTT
AGTGGACTGATGGTAGGAATCTTTTTTGGTATCAATCAATTGTTAATTAC
GTTGGGAATATTTAAAAATTAA
50
100
150
200
250
300
350
372
View in model
Transcription unit TU_031 View in model
Empirical formula (pH 7.5) H3983C3610N1530O2559P372
Molecular weight (pH 7.5; Da) 121268.06 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3927600
pI 3.75
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:12
Last updated 2012-10-01 15:12:45