MG_054 – transcription antitermination protein NusG, putative

Name
WID MG_054 View in model
Name transcription antitermination protein NusG, putative View in model
Symbol nusG
Protein product MG_054_MONOMER
Cross references GenBank: AAC71270.1, CMR: MG_054, BioCyc: MG_054, SwissProt: P47300
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 6053566486 MG_051 MG_052 MG_053 MG_054 MG_055 MG_056 MG_057 MG_474 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 63035 (nt), Length: 951 (nt), Direction: Reverse, G/C content: 30.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
ATGCAAGCTAGTGAATTAACACCAAAGTGGTATGTAGCTCCTGTTAGTAT
TAAAGATGAAGCTGTTGTAAAAAATCTAAAAGCTAAAATTCAAGCTTTAG
GATTTAATCATGAGATTGTTGATGTTAAAGTTCTAAAAGAAAGGGAAGTT
CATGAAGAAGTTTATTCATTAAAATCAGGAAAACTTCCTCGTTCCTTAAA
GAACACTACTTTTAACAAATGGTTTGTTCTTGATGATTACCGTTATCTTA
GGGTAAAAATTAGTGAAAAAAATCTCCTTGGTAGATACATCTACATAAAG
ATGATTTATAGTGAAGATGCTTGAAGAATTGTTCGTAACTTCCCTGGGAT
CACTGGCATAGTAGGTTCTTCTGGCAGGGGTGCTTTACCTATCCCTTTAG
ATGAAAAAGATGCTAATAATTTAGAACAAATGCTTAAAGGGATATCAATC
AATCCTAGCAAACGAATTATGCTAACAAATACTGCCATTATTGAAATGGA
CAGTGATAAATTTGATGAAAAATTTCAATATATCTTAAAACAAAAACAAG
CCATTCAAAAACCAAAAGAGGATGAAGATTCAGAAATTGTTGATGCTGAA
AAACTAAAAGAAGCTTTTAAAAAACTACAAAATAGTCAAGAACAAGATGA
ATGGAAAGAAAAAGCAACGATTATTCAAAGTGAGCAAACCAAACTTGATC
CATCAGTATTAGTTCCTTTTTTGGGCAAATATGAAATTCTTGATACTGAC
AATAAAGTTGAACAACTCTTTGAATTTAGTGTTGGTAATTTAGTAGAGGT
ACATTTAACTGATACTATTCATGTTCAAGGACAGATAAAAGCACTTTATC
AAGGTACAGTTAACAAAGCAGTTGTAGAGATAGAATTAACATCTAAAACC
CAATTAATTAACTTACCTTTAGAAAATTTAAGCTTTGTTGAGTTTGAGTA
A
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
951
View in model
Transcription unit TU_031 View in model
Empirical formula (pH 7.5) H10175C9223N3894O6573P951
Molecular weight (pH 7.5; Da) 310192.30 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
3.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9962300
pI 3.81
 
Comments
Comments transcription antitermination has not been reported in any mycoplasma [PUB_0182]; rho not essential in B. subtilis [PUB_0234]; the five sequenced members of the pneumoniae clade all contain most of the necessary machinery for forming an [PUB_0182]; elongation factor [PUB_0233]; supresses pause sites [PUB_0233]; simulates rate of transcription [PUB_0233]; may connect Rho to RNA polymerase-RNA complex [PUB_0233];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Ciampi MS. Rho-dependent terminators and transcription termination. Microbiology 152, 2515-28 (2006). WholeCell: PUB_0233, PubMed: 16946247

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Peterson JD, Umayam LA, Dickinson T, Hickey EK, White O. The Comprehensive Microbial Resource. Nucleic Acids Res 29, 123-5 (2001). WholeCell: PUB_0182, PubMed: 11125067, URL: http://cmr.jcvi.org/

  5. Washio T, Sasayama J, Tomita M. Analysis of complete genomes suggests that many prokaryotes do not rely on hairpin formation in transcription termination. Nucleic Acids Res 26, 5456-63 (1998). WholeCell: PUB_0234, PubMed: 9826772

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:12
Last updated 2012-10-01 15:12:45