MG_052 – cytidine deaminase

Name
WID MG_052 View in model
Name cytidine deaminase View in model
Symbol cdd
Protein product MG_052_MONOMER
Cross references GenBank: AAC71268.1, CMR: MG_052, BioCyc: MG_052, SwissProt: P47298
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 5851463907 MG_049 MG_050 MG_051 MG_052 MG_053 MG_054 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 61014 (nt), Length: 393 (nt), Direction: Forward, G/C content: 29.8%, Sequence:
1
51
101
151
201
251
301
351
ATGAAGGTGAATTTAGAGTGGATAATTAAACAGTTACAAATGATAGTTAA
AAGAGCATATACTCCCTTTTCTAACTTTAAAGTTGCATGTATGATTATTG
CTAACAACCAAACTTTTTTTGGAGTTAACATTGAAAATTCTTCCTTTCCA
GTAACTTTGTGTGCTGAAAGAAGCGCCATTGCTAGCATGGTTACAAGTGG
TCATAGGAAAATTGATTATGTTTTTGTTTACTTCAATACTAAAAATAAGA
GTAACTCACCCTGTGGAATGTGCAGACAAAACTTACTGGAATTTTCCCAT
CAAAAAACAAAGCTTTTTTGTATTGATAATGATAGTAGTTATAAACAATT
TTCCATTGATGAATTATTAATGAATGGTTTTAAAAAGAGCTAA
50
100
150
200
250
300
350
393
View in model
Transcription unit TU_030 View in model
Empirical formula (pH 7.5) H4188C3794N1557O2748P393
Molecular weight (pH 7.5; Da) 127737.17 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
6.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4063300
pI 4.12
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:12
Last updated 2012-10-01 15:12:45