MG_050 – deoxyribose-phosphate aldolase

Name
WID MG_050 View in model
Name deoxyribose-phosphate aldolase View in model
Symbol deoC
Protein product MG_050_MONOMER
Cross references GenBank: AAC71266.1, CMR: MG_050, BioCyc: MG_050, SwissProt: P47296
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 5658262254 MG_048 MG_049 MG_050 MG_051 MG_052 MG_053 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 59082 (nt), Length: 672 (nt), Direction: Forward, G/C content: 32.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGAAATTAGAATACAACCGGATTATTGATAGCACCTTAGTCAAAGCTGA
TACGCTTCCCCATGAAATAGATACTTTATGTGCTGATGCTCATAAATACC
AGTTTTTTGCAGTGTGTGTTAATCCTAGTTATGTTAGTTATGCTAAAAAC
ATCTTGAAAAATACTGCAGTTCAACTCTGTTGTGTTGTTGGTTTCCCCTT
AGGACAAACAACCCAAAAACAGAAGGTATATGAAGCTAAGATTGCTATTA
AAGAGGGAGCGGATGAAATTGATATGGTAATGAATATTGCTGAGTTTAAA
AAACGTTGTGCTTGTGTTATTACTGAAATTAGAGCTGTTAAAAAAGTGTG
TGGCAAGCGTAAATTAAAAGTAATTATTGAAACTGCACTTTTAACAAATG
ATGAAATCAAAGATGCAGTTAATGTTTGCATTGATGGCAATGCAGATTAT
GTTAAAACTTCCACTGGTTTTTCTTTCCGTGGTGCATCTTTAGAAGATGT
TCAGATTATGAATAATGCTGCAGCAAATTTAATTAAAATCAAAGCTTCAG
GTGGGATTAAAACAGCAAAGCAATTTATAGATTTATTTCAAGCTGGAGCT
AGTAGAATTGGAACTTCAAATGCGGTCCAAATAATGCAAGAATTAAAAAA
AATGAACCATGAATATCATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
672
View in model
Transcription unit TU_029 View in model
Empirical formula (pH 7.5) H7181C6508N2724O4677P672
Molecular weight (pH 7.5; Da) 219201.20 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
14.7 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6958500
pI 3.97
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:12
Last updated 2012-10-01 15:12:45