MG_049 – purine nucleoside phosphorylase

Name
WID MG_049 View in model
Name purine nucleoside phosphorylase View in model
Symbol deoD
Protein product MG_049_MONOMER
Cross references GenBank: AAC71265.1, CMR: MG_049, BioCyc: MG_049, SwissProt: P47295
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 5586261579 MG_047 MG_048 MG_049 MG_050 MG_051 MG_052 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 58362 (nt), Length: 717 (nt), Direction: Forward, G/C content: 33.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
ATGACCCCACATATAAGTGCTAAGAAAGATGACATTAGCAAAGTTGTTTT
AATGCCAGGTGATCCATTGAGAGCTAAATGGATAGCTGAGCAATTCTTAG
ATCAAGCTAAATTAGTCAATGAAGTGAGGGGAATGTTTGCTTATACTGGG
CAGTATAAATCTAAAACAGTTACAGTAATGGGCCATGGAATGGGGATCCC
TTCTATTGGAATTTATTCATATGAGTTGATGAATTTTTATGAGGTTGAAA
CTATCATTAGAATCGGAAGTTGTGGTGCTTTAGCACCGCAATTAAAATTA
AAAGATCTTGTTATTGCTTCAAAAGCATGAAGTGAGTCTATTTATGCTAA
AGACATGGGTGTTGAAATTCCAGAAGATAAGATCTTATTTGCAACAAGTT
CTTTAGTGGAATTAGCAAAAGAAACTGCGATTAAGAACAAGCTTGATTTT
CATGAAGGATTAGTATTTTGTGAGGATGCTTTTTATCAAACTAGAAAAGA
TGTAATTAGTCTTGCTAAAGAAAAAAATAGTTTAGCAGTTGAAATGGAAG
CACATGCACTTTATGCTAATGCAATCCTGTTGAAGAAAAAAGCACTTACA
CTCTTAACAGTATCTGATTCTCTAGTAACTCATGAAGCACTTAGTTCTGA
ATTAAGACAAAAGTCATTTAAGCAAATGGCTTTATTAGCACTTGAAATGA
CTCAAAAACTAATCTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
717
View in model
Transcription unit TU_029 View in model
Empirical formula (pH 7.5) H7666C6948N2919O4986P717
Molecular weight (pH 7.5; Da) 234043.69 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
9.7 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7438800
pI 3.94
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:11
Last updated 2012-10-01 15:12:44