MG_041 – PTS system, HPr

Name
WID MG_041 View in model
Name PTS system, HPr View in model
Symbol ptsH
Protein product MG_041_MONOMER
Cross references GenBank: AAC71257.1, CMR: MG_041, BioCyc: MG_041, SwissProt: P47287
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 4687652143 MG_039 MG_040 MG_042 MG_043 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 49376 (nt), Length: 267 (nt), Direction: Forward, G/C content: 33.3%, Sequence:
1
51
101
151
201
251
ATGAAAAAATTTCAAGCAGTTATTAAAGACCCAGTGGGAATTCACGCACG
TCCTGCTTCTATCCTTGCAAGTGAGGCTAGTAAGTTTAAATCTGAACTTA
AACTGGTAGCTCCAAGTGGTGTTGAAGGTAATATTAAATCAATTATTAAC
TTAATGTCTTTAGGAATTAGACATAATGACAACATTACTATCAAAGCAGA
TGGAGCTGATGAAGAAGAAGCTTTAGCAGCTATTAAAGCTTGTCTTGAAA
AAAATAAAGTTATCTAA
50
100
150
200
250
267
View in model
Transcription unit TU_024 View in model
Empirical formula (pH 7.5) H2859C2591N1098O1850P267
Molecular weight (pH 7.5; Da) 87249.56 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
5.77572 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2753900
pI 3.83
 
Comments
Comments Part of the PTS [PUB_0440];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Ren Q, Chen K, Paulsen IT. TransportDB: a comprehensive database resource for cytoplasmic membrane transport systems and outer membrane channels. Nucleic Acids Res 35, D274-9 (2007). WholeCell: PUB_0440, PubMed: 17135193, URL: http://membranetransport.org/

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:11
Last updated 2012-10-01 15:12:43