MG_031 – DNA polymerase III, alpha subunit, Gram-positive type

Name
WID MG_031 View in model
Name DNA polymerase III, alpha subunit, Gram-positive type View in model
Symbol polC
Protein product MG_031_MONOMER
Cross references GenBank: AAC71247.1, CMR: MG_031, BioCyc: MG_031, SwissProt: P47277
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 2985939215 MG_028 MG_029 MG_030 MG_031 MG_032 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 32359 (nt), Length: 4356 (nt), Direction: Reverse, G/C content: 30.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
2151
2201
2251
2301
2351
2401
2451
2501
2551
2601
2651
2701
2751
2801
2851
2901
2951
3001
3051
3101
3151
3201
3251
3301
3351
3401
3451
3501
3551
3601
3651
3701
3751
3801
3851
3901
3951
4001
4051
4101
4151
4201
4251
4301
4351
ATGGTATTTAATCTTGAGAATGAAAAAGATAAAAAGGTTCTTGCACTCTC
CAATTTTTTGATAGATAACAATATCCTTGACCACAATGAGCTTAACAGCT
TAATTGAAAGGATTGAATCAATTTACTTTAATAAATATATTGAAGAGAAG
GTTTTTCTATTTGCAATAACTATTAGTCGCCCTTTAACTATTGATATTTG
AAATGCTTTATATGAAGGATTTAATGAATTAAATGAGGGATTTAAAGCTG
ATAATGAATCTTTTAAACTTACCATTACCTTTAAGGAGAATGAGCCATTC
TTTAAATCAAAAAATAGTTTTTCTTCTGTAACGATAGCTATTATTAAAGA
CTATTTTCACAGTTTCTTTTCAAAAGATAAGAAATACAAAATTCTCATTG
AACAAGAGTTAAGTAATCCCAATTTTCTTAGTTATGAAAATGACGAATTA
AAAGCACAATGTCAAACCAAAGAATTAACTGAATGATTAGTTCAAAAAAG
TAAATCTTTCATTTTTTGGATGAATAATGCTGGTTTTAAAAACTTTAACT
TCATTGCACTTTATCCTATTGATAAAAATGAATCTAAATTAAAAGTAAAA
GCTGTAACTGTTTCTCAATATGATAAGCAGTTTGAAACAAAGGTATTTGC
AACAGAATTTATCCCTATCCACAAGATTAACCAACAGATCGATGATGTCA
AGATTATTGGGCAAATCTTTGAATTAAAAACCCATGAAAGTTTAACTGGT
AAAAAAACACTTAATATCTATGTAACTGATTTTCAATTAGGTGGATCGTT
AATTTTGAAATGATCCTATACTGATGAAAAAAAGATTGAAGGAATTACTA
TTGGCAATTGGATAAAAGCCCATATCCAAGTAGAACGTGACCCTAATACT
CAAATCTTATATGGAATTGTTAGAGAGATAAATCCTGTTGAAATACCTAA
TAACTATAAAAGGTTAGATTTATCAAAACAAAAGCGAGTGGAGTTAGTTT
TTCATACTAAAATGACTGCTTTTGATGGTATCAATGACATTGAAGAATAT
GCACAGTTTGCTAAAGAAAGAGGTTGAAAAGCAATAACTGTTACAGATAA
AGATAATATCCATATTTATCCCAAGTTTTATGAAGTGGCTAAAAAATATG
ATTTAAAAGCTATCTATGGTTTGGAATTCAACTTAACTGATGATCACATC
AAAATTGTTCACAACCCAGATAACACTAAGTTAAGTGATGCCACCTTTGT
TATTTTTGATATTGAAACCACTGGATTACATGGTAGGTATGATGATGTTA
TTGAGTTTTCAGCACGCAAAATTAAGAATAACAGCGAGATAGATCATCAG
CAATTCTTTTTAAAAATTGACAAACCTATCCCAAAAACAATCACTGAAAT
CACCAAAATAACTGATGAGATGCTTGAAGGCGGTATTGATCAACAGCAAG
GTTTAGAAAAGATAAGAAATTATCTAGATGATTGTGTTATGGTAGCTCAT
AATGGTATTAATTTTGATTTACCCTTTTTGCAAACTCAATTTGAAAAATA
CAACATCAAACCATTAACAAACCCACTGATTGATACCTTATGTTTATCAT
GAGCATTGAATCCCTTGTTTTCATCCCATACTTTAAGCAATATTTGTTCT
AAACTAAAACTTGAATTTGATGATGAAAGATTACACCGTGCTGAATATGA
TACAGAAGCTTTAAAAAAAGTTTTCTTTTACTTTAAAAAGCAGTTAAAAG
AAATGGGTATTAATACCTTAACAGAGATAGATCAAAACCTAAATAAAAAG
TGTCAAATTGATCTGATGAAAAGGGTATTTACAAACACAGCAATCGTTTA
TGTAAAAAACCAACGGGGCTTTCAAAACCTATATGAGATGTTATCAATTG
CATTAACAGATCATAATGCTAACAGACCATTAGTTTTAGCTAGCAGCTTA
GCTAAATTTAGAAAATCTTTTTTATTAACAGAAAACCCTGTTCAGGGTGA
CATCTTTAAAGCTGCATTAACAAAACCAATTAATGAACTTGAAAAAGCAA
TTGAAAAAGTTGACTTTGTGCTTATTTCACAACCCAATGCTTACCTTGGT
TATACACTACGTGAAGGACTGAAAAAAGAACTTATTAATGATGCAATCAA
ACTAGTTATCAAAACAGCAACAAAACTTAAGAAATTAGTTGCTGTTGCAT
CTGATGCTTACTTTATCCATCCTTGGGAAAATGAATATTATAAGGCAATA
GTTTGTGCTAAGGGCTTAGGTGGGAAATGACATAGACACTTTAACAATAA
AGAAAAAGAACAAACCGTTCCTGAAGTATTTCTTCACACCACTGATGAGA
TGCTAAAAAGAATGAGTTTTTTAGGAGAAGATATTGCCTATAAATTAGTC
GTTGAAAACACTAATAAGATAGTGAAGCTACTTGACTTAAATGAATTAGT
ACCAACTAAAAACAAGCTTTATCCACCAGTGATGCAAGATTCTAACCAAA
AATTAATTGATAAAACTTGAAAACAAGCTGAAAAAAGGTATGGTAAAAAT
TTACCTAAACTTATTAAGGAAAGAATTGAAAAAGAACTAAATGCAATCAT
TAGTAATGGTTTTGGAATTGTCTTTTGAATTTCCCATCTATTAGTAGAAC
AATCTGTTAAAGATGGTTATTTTGTAGGTCCACGTGGTTCTATAGGCTCT
TCTTTAATTGCTAATTTAATTGGTATATCAGAAATCAATCCATTAGCTGC
TCATTATCTTTGTGAACAATGTCATTACTTTGAAGTTAGTGACAGTGTTG
ATGATGGATATGATTTGATGATTCGTGATTGTCCTAAATGCCATGAAAAA
GCAAGTTTCAAAGGTGATGGTCATAACATTCCTTTTGCTACTTTTATGGG
TTTTTCTGGTGATAAAATTCCTGATATCGATCTTAATTTTTCTAGCGAAT
ATCAAGCTAAAGCCCATGATTATGTCAGAAAATTATTTGGAGTTAATAAC
ACCTTCAGGGCAGGAACAATTGCAACAGTTGCTGAAAAAACTGCTTATGG
TTATGCTAGAAACTATTTTGAAATCATTAAACGTGTTGATCTTGCAACTA
CTGCTGAAATTGAAAGATTTAAACAAAAGCTTATAGGAATTAAGAGAACA
ACAGGGCAACATCCAGGGGGAATTATGATCTTTCCTAGTGATCATTCTGT
TTATGAATTTACTCCCTGTGGTTTTCCAGCAGATGATGTTGAAAGTGAAT
GAAAGACCACCCATTTTGAATATGATGCATTAGGTGATGCCATATTAAAA
CTTGATATCTTAGGTCAAGATGATCCAACAATGTTAAAGCACTTAGCTGA
TCTAACTAAGATAAATCCCCAAAATATCCCTCACTTTGATAAGAACTTAA
TTTCGATGTTTTCTTCAAACAAACCATTAAACCTAAAACCAGGCATTGTT
GATGAAGTTACAGGAGCGGTTGGTATCCCTGAATTTGGGACTAAATTTGT
TAGAAAAATTTTAGAACAGACAAAACCTAAAGACTTTGCTGACTTAATTA
GAGTTTCAGGATTAAGCCATGGTAAAAACGTGTGAGCAGATAATGCACAA
AAACTAATTAAAAGCAATAGGTTAACTTTAAGAGATGTAATTGCTTGTAG
AGATGACATCATGCTTTATCTAATTAATAAAGGGATGCAAGCAAAAGATG
CTTTTGAAATCATGGAAAAAGTAAGAAAAGGTATTAAAGTAAATGCTAAA
GAAGTTAGCCTGATGCAAAACTGTGGTGTTGAACAATATTGGATTAATGC
TTGTTTAAAAATTAATTATCTATTCCCTAAGGCACATGCTGCAGCTTATG
TTTTAATGGCTTGAAGAATTGCTTGATTTAAGCTTTATCACCCTTTGAGT
TACTATGCTTGTTTATTAAGTTTCAAACTAAAGGAACATGATATTAATGG
TTTTGAAAAAGGGTATGAATTTATTAAAAACCGTTTAGATGAACTTAATA
AGCTTTACAGAATAAAAAAGATTAAACCAAAAGAAGCGGAGCTTTTAACA
AGTTATGAAGTTTATTTAGAAATGATGGCACGCAATATAAAGTTGCAACA
AATCTCTATTCAAAACTCTAATGCAAGGATGTTTGTTGAACATAATGGTG
TTTTAATTGCGCCTTTCATCACTATTCCAGGAATGGGAGAAGCGGTAGCT
TCTTCAATTGTAGAAGCAAGAAATGAAAAACCATTTGCTTCCTTAAATGA
TTTCAAAAAAAGAACCAAAATTACTAAAAAACACGTTGAAACGATGGAAC
AATTACAACTGTTTGATGAATTTGAACATCAAGATGATCATAAACTTTTC
AACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
2050
2100
2150
2200
2250
2300
2350
2400
2450
2500
2550
2600
2650
2700
2750
2800
2850
2900
2950
3000
3050
3100
3150
3200
3250
3300
3350
3400
3450
3500
3550
3600
3650
3700
3750
3800
3850
3900
3950
4000
4050
4100
4150
4200
4250
4300
4350
4356
View in model
Transcription unit TU_014 View in model
Empirical formula (pH 7.5) H46536C42179N17637O30231P4356
Molecular weight (pH 7.5; Da) 1419138.85 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
45414300
pI 3.90
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:11
Last updated 2012-10-01 15:12:42