MG_029 – DJ-1/PfpI family protein

Name
WID MG_029 View in model
Name DJ-1/PfpI family protein View in model
Protein product MG_029_MONOMER
Cross references GenBank: AAC71245.1, CMR: MG_029, BioCyc: MG_029, SwissProt: P47275
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 2864334204 MG_025 MG_026 MG_027 MG_028 MG_029 MG_030 MG_031 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 31143 (nt), Length: 561 (nt), Direction: Reverse, G/C content: 28.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGAAAAAGATACTTGTTATTGTCTATCCAGAGATGAATGATGTTGAATA
TACTAATGTAATGGTTGTATTTAGTTTCATTAAAACAATACAAACAACAT
GTTATCACCATTCATTAAAAAAGATAACTGCTAGTAATGGTGTTGTTGAA
GTTAACAATATTGTCAACACCATTAACTTATCAGAATTTGATGCAGTTTA
TATTCCCGGTGGAATAGGAGCTACAAAACACTTAGATAAAGATGAAAAAC
TGCTTAAAACAATTAATTATTTCAAAGTAAATAACCTTTATCTTTTTGCT
ATTTGTGACACACCGAATGTTCTATTTAAACATGGTATTATCACTAAAGA
TGAGATCTATTCTTCTTTTCCAAACCCAAATTTAGTTATGTCTGAAAACA
GATCAACAGCAAAAGTAACAGTAGCAAATAAATTAATAACAGCAAGAAGT
GCTGGTTGTGCTTTGGAATTTGCAACAGTTATTGTGTGCACTTTTTTAAA
AGATAACACTTTAAATGAGCTTGTTCATAAAAGGTTATTTGGTAGTGAAA
TTAAAGACTAG
50
100
150
200
250
300
350
400
450
500
550
561
View in model
Transcription unit TU_014 View in model
Empirical formula (pH 7.5) H5984C5422N2241O3905P561
Molecular weight (pH 7.5; Da) 182396.26 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5850900
pI 3.99
 
Comments
Comments involved in oxidative stress response [PUB_0110];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:11
Last updated 2012-10-01 15:12:41