MG_027 – transcription termination/antitermination protein NusB

Name
WID MG_027 View in model
Name transcription termination/antitermination protein NusB View in model
Symbol nusB
Protein product MG_027_MONOMER
Cross references GenBank: AAC71243.1, CMR: MG_027, BioCyc: MG_027, SwissProt: P47273
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 2759333049 MG_024 MG_025 MG_026 MG_027 MG_028 MG_029 MG_030 MG_031 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 30093 (nt), Length: 456 (nt), Direction: Forward, G/C content: 28.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGGCAATTACCGTGAAAGGTTTAACAAATAAATTAACTAGAACCCAAAG
ACGAATTGCTGTAGTGGAATTTATCTTTTCTCTCCTCTTTTTCTTACCTA
AAGAAGCTGAAGTTATTCAAGCAGATTTTTTAGAGTATGATACTAAAGAA
CGACAACTAAATGAATGACAAAAACTAATTGTTAAAGCATTTAGTGAAAA
TATCTTCTCTTTTCAAAAGAAAATTGAAGAACAACAATTGAAAAATCAAT
TAGAAATTCAAACTAAATACAATAAAATATCAGGAAAAAAGATTGATCTT
TTAACTACTGCAGTTGTTTTATGTGCACTTAGTGAACAAAAGGCACATAA
TACTGATAAACCACTTTTAATTAGTGAGGCATTGTTGATTATGGATCATT
ATTCACAAGGTGCTGAAAAAAAACAAACTCATGCTTTATTAGATAAGCTC
TTGTAA
50
100
150
200
250
300
350
400
450
456
View in model
Transcription unit TU_013 View in model
Empirical formula (pH 7.5) H4875C4418N1854O3151P456
Molecular weight (pH 7.5; Da) 148483.37 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
3.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4754400
pI 3.81
 
Comments
Comments may align with rsmB;rsmB catalyzes m5C967 modification of 16S rRNA [PUB_0105]; aligning base in M. gen 16S rRNA is G not C;
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Peil L. Ribosome assembly factors in Escherichia coli. Tartu University (2009). WholeCell: PUB_0105, URL: http://dspace.utlib.ee/dspace/handle/10062/10503

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:10
Last updated 2012-10-01 15:12:41