MG_025 – Beta-glycosyl transferase

Name
WID MG_025 View in model
Name Beta-glycosyl transferase View in model
Symbol trsB
Protein product MG_025_MONOMER
Cross references GenBank: AAC71241.1, CMR: MG_025, BioCyc: MG_025, SwissProt: P47271
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 2615232049 MG_022 MG_023 MG_024 MG_025 MG_026 MG_027 MG_028 MG_029 MG_030 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 28652 (nt), Length: 897 (nt), Direction: Forward, G/C content: 29.1%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
GTGCCAAGTAAGTATTTATTCACCGTTATAATTCCAACATACAATTGTTG
TCAATACATAAAAAAGGCATTAGATTCATTGCTTTTACAGAATGAATATT
TTTTAAAAACACAAGTACTAATAGTTAACGATGGTTCACTAGACAATACT
AAGGAAGTTGTTAGTGACTATTTAATAAAGTACTCCAATATTAGTTATTT
TGAAAAAACTAATGGTAATTGGGGTAGTGTTATTAACTATGTTAAAAAAA
ATAAATTAGCCTTAGGTCAATATATTACTGTTTTAGATAGCGATGATTAT
TTTTTAAAAGATAGTTTTAAAAAAGTGGCTCGTTTCTTTGGCCATGACAT
GATCATTGGCGCTTTTTATTGTTATATTAATGAAAATAAAACTCGTTTTT
TAAAACCTTATTTCGGTAAGACTGGTGTTATTAAAGAACATACCAAATTA
AGAACCCCCCATTCCCAACCTATTGCTAAATTTTACAGTAATAAACTTTT
CTATGAACTACATGATCTTAAGGAAAAGTTATTCTTCCAGGATTGTTTAA
TGTATCACGATGCTATTAACAGAGTTGAAAGTGTTTTTTATTTGCGAGAG
CCTTTAGCAGTTTGGTTTTCTACAAGACCTGGCAATTCTACAACAACTTC
TTGAGAAAATCCAAATAAATTTAATGCTTGGTGTGAAATTCTCCAAAAAA
TGAATTTGTATGGAGCTGGGATAGTAATCTACATCTATACTATGCTACCT
GGATTTCTAAAACAACTAAAGAAAAAACAACTAATACTGAATTTGAACCA
TAAACCAGCTTACACTTGATTACCTAAACCTTTAGCGTTTATTTTTGGTG
GTTTAATGGCATTTAAAACCAGAAAATACATTAAATATCCTAAGTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
897
View in model
Transcription unit TU_012 View in model
Empirical formula (pH 7.5) H9555C8657N3546O6270P897
Molecular weight (pH 7.5; Da) 291374.61 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9310100
pI 4.09
 
Comments
Comments Synthesize oligosaccharides, polysaccharides, and glycoconjugates by transferring the sugar moiety from an activated nucleotide-sugar donor to an acceptor molecule, which may be a growing oligosaccharide, a lipid, or a protein, for example: (malQ, coli): (glucose)n + (glucose)m (glucose)n+m-1 + alpha-D-glucose [PUB_0110]; LPS O:3 antigen (homopolymer of 6-deoxy-L-altrose repeating units linked by 1,2 linkages) biosynthesis; NDP-sugar hexosyltransferases; group 4 nrd2 glycosyltransferases: cell surface polysaccharide (CSP) biosynthesis [PUB_0238]; Suthers et al [PUB_0610] annotates MG_025 as a minor teichoic acid synthase. However evidence for this annotation is weak.
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Kapitonov D, Yu RK. Conserved domains of glycosyltransferases. Glycobiology 9, 961-78 (1999). WholeCell: PUB_0238, PubMed: 10521532

  5. Suthers PF, Dasika MS, Kumar VS, Denisov G, Glass JI, Maranas CD. A genome-scale metabolic reconstruction of Mycoplasma genitalium, iPS189. PLoS Comput Biol 5, e1000285 (2009). WholeCell: PUB_0610, PubMed: 19214212

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:10
Last updated 2012-10-01 15:12:41