MG_024 – GTP-binding protein YchF

Name
WID MG_024 View in model
Name GTP-binding protein YchF View in model
Symbol ychF
Synonyms engD, gtp1
Protein product MG_024_MONOMER
Cross references GenBank: AAC71240.1, CMR: MG_024, BioCyc: MG_024, SwissProt: P47270
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 2484630950 MG_021 MG_022 MG_023 MG_024 MG_025 MG_026 MG_027 MG_028 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 27346 (nt), Length: 1104 (nt), Direction: Forward, G/C content: 29.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
ATGTTAAGTGCAGGGATAGTTGGTTTACCTAATGTTGGTAAGTCAACTTT
ATTTAGTGCTATTACTAATTTGCAAGTTGAAATAGCAAACTATCCTTTTG
CAACTATAGAACCTAATACTGGCATTGTTAATGTTAGTGATGAGAGATTA
GATAAATTAGCTAGCTTAATTAATCCTGAAAAGATAGTTTATACAACCTT
TCGTTTTGTTGATATAGCAGGTCTTGTTAAAGGCGCCAGTCAAGGTCAAG
GATTGGGTAATCAATTCTTAGCAAACATCCGTGAAGTGGATTTAATTTGT
CATGTTGTAAGATGTTTTCAAGATAAAAAAATTGTTCATGTTAACAATAC
AATAGATCCTGTTTTTGATTTTGAAATTATTGTTAATGAACTAATCCAAG
CTGATTTTGAATTAATAACAAACAGAATCGGCAAGCTTAAAAGAAAAGCT
GAATCAGGTGATAAAATCGCTAAAGAAGAGTTTGTATTACTTGAAATTGT
TTTAAATGGATTAAAACAAGGTCAAATGCCCATTCAGACTCTAAGTGAAA
GTGAATTGAAAACAATTAAATCACTTAATCTATTAACAGCTAAACCTATT
CTAATAGTAGCCAATGTATCTGAGAATGACTTATTAAACCTTGATAATAA
TGAAGCTTTAAAAAAATTGAATGCTTTTCTTGATCAAAAAAAGATTCCCA
AGGCAATCACAGTTTGTTCTTTAATTGAAAAAGAATTAAGCGGTTTGAAA
TTAGAACAACGTCAATACTTTTTGGATGAACTTGGCTTAAAAAATTATTC
AGGTTTAAACCGAGTAATTCAAGCTGCATATCAAACTTTAAACCTTTGGT
CTTTTTTTACTTTTGGTAAAAAAGAAGTTAGAGCATGAACATTTAAAAAG
GGTTGAAATGCTCCTCAGTGTGCTGGGCAAATTCATTCTGATTTTGAAAA
AGGATTTATTAAAGTTGAAGTAATTAGTTGAGATCAATTGTTTGCAATGA
AATCTTTACAAGAAGCTAAAAAACAAGGTTTGATAAGATTGGAAGGCAAA
AATTACTTAATAAAAGATGGTGATGTTTGTAACTTTAAATTTAACGTCAC
TTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1104
View in model
Transcription unit TU_011 View in model
Empirical formula (pH 7.5) H11775C10670N4410O7692P1104
Molecular weight (pH 7.5; Da) 359054.20 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
2.7 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
11530800
pI 4.04
 
Comments
Comments translation associated P-loop GTPase [PUB_0110]; double-stranded nucleic acid binding domain [PUB_0215]; possibly binds looped RNA [PUB_0215]; yeast ychF interacts with multisubunit translation elongation factor eEF1 [PUB_0215]; downregulated under DNA damage [PUB_0215];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Teplyakov A, Obmolova G, Chu SY, Toedt J, Eisenstein E, Howard AJ, Gilliland GL. Crystal structure of the YchF protein reveals binding sites for GTP and nucleic acid. J Bacteriol 185, 4031-7 (2003). WholeCell: PUB_0215, PubMed: 12837776

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:10
Last updated 2012-10-01 15:12:41