MG_023 – fructose-1,6-bisphosphate aldolase, class II

Name
WID MG_023 View in model
Name fructose-1,6-bisphosphate aldolase, class II View in model
Symbol fba
Protein product MG_023_MONOMER
Cross references GenBank: AAC71239.1, CMR: MG_023, BioCyc: MG_023, SwissProt: P47269
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 2397929846 MG_020 MG_021 MG_022 MG_023 MG_024 MG_025 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 26479 (nt), Length: 867 (nt), Direction: Forward, G/C content: 31.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGCTTGTTAACTTTAAATTGATGCTTCAAAAAGCAAAGCTAGGTAAATA
TGCAATCCCTCACATTAACATCAATAACTATGAATGGGCCAAAGCTGTTT
TAACAGCAGCAAATCAAGCTAATAGCCCAATTATTGTTTCAGTATCTGAA
GGTGCTTTAAAGTACATGTCTGGTTATAGTGTTGTTATCCCGCTTGTTAA
GGGTTTAATTGAATCACTAAGTGTTAAAGTACCAGTGACATTACATTTAG
ATCATGGTAGTTATGATGCATGTATCCAAGCATTACAGGCTGGATTTAGT
TCAGTAATGTTTGATGGTTCACATTTACCATTTGAAGAAAATTTCAATAA
ATCTAAAAAGTTAATAGAGATAGCACAAAAAACAAATGCTTCTGTTGAAC
TTGAAGTTGGTACTATTGGTGGAGAAGAAGATGGTGTTATAGGACAAGGT
GAGTTAGCTAATGTTGATGAATGTAAACAAATCGCTAGTTTAAAACCAGA
TGCTTTAGCAGCAGGAATTGGTAATATCCATGGTATCTATCCTAAGAATT
GAAAAGGATTAAACTTTCCTTTGATTGAAACAATATCAAAAATTACTAAC
TTACCCTTAGTTTTACATGGTGGCTCTGGAATCTTAGAAAATGATGTTAA
AAAAGCAATTAGTTTAGGGATTTGCAAACTAAATATTAATACTGAGTGTC
AATTAGCATTTGCACATGAAATTAGAAAATACATTGAATCAAATAAAGAC
TTGGATCTTAACAAAAAAGGTTATGATCCTAGAAAACTTTTAAAAGAACC
TACTCAAGCAATTGTTGATACTTGCTTGGAAAAGATTGATTTGTGTGGTT
CTAGAAATAAAGCATAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
867
View in model
Transcription unit TU_011 View in model
Empirical formula (pH 7.5) H9262C8394N3507O6031P867
Molecular weight (pH 7.5; Da) 282621.15 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
7.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9025200
pI 3.97
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:10
Last updated 2012-10-01 15:12:40