MG_020 – proline iminopeptidase

Name
WID MG_020 View in model
Name proline iminopeptidase View in model
Symbol pepP
Synonyms pip
Protein product MG_020_MONOMER
Cross references GenBank: AAC71236.1, BioCyc: MG_020, CMR: MG_020, SwissProt: P47266
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 2104226969 MG_018 MG_019 MG_020 MG_021 MG_022 MG_023 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 23542 (nt), Length: 927 (nt), Direction: Forward, G/C content: 30.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
ATGAATACAAAACTTAATGTAAAAGGTTATCTAAATGTTGGTGATAACCA
TCAACTTTATTACTGAACACAAGGAAATCCTAATGGTAAACCGGTTTTGT
ATATCCATGGCGGACCTGGTTCTGGTACTGATGAAGGATGTTTAAAGTAT
TTTGATCTTGAAACAACTTGGATTATTTTATTAGATCAAAGAGGTTGTGG
TAAGAGTAAGACTAATGATATCTTTTATGAAAATAACACTGATAAATTAG
TTAGTGATTTTGAAATTTTACGTCAAAAATTAAACATTAAAAACTGAACA
CTCTTTGGTGGTAGTTGGGGTTCTGCACTTGCTTTAGTTTATGCAATTAA
ACACCCACAAGTAGTTGATAAGATCTTTTTAAGAGCACTTTTTTTAGCTA
GAGAAAAAGACTGATCTGAAGCTTTAATGGGATTAGGAAAAATGTTTTAT
CCTTATGAACACCAACGCTTTATGGATAGTATTCCTAAAGCTTATCAGAA
CAGTTATGAACAAATTGTTAACTACTGTTATGATCAATTTCAAAATGGTG
ATGAATCAACCAAAGAAAAACTTGCTAAAGCTTGGGTGGATTGAGAATCA
ACATTACTTTCACCTATTAACAAAATTCATTCAACAGCAACAGACTTTAA
ATTAGTTGAAAAACTAGCTTTATTGGAATGTCACTATGCAGTTAATAAAA
GTTTTTTGGATGAAAACTTCATTCTAGATAACATTAGTGTTCTTAAAAAT
AAAAGTATTTATTTGGCTCATGGTAGATTTGATCTGATCTGTCCTTTATA
TCAACCATTAGCATTAAAACAAGCATTCCCTGAATTACAACTTTATGTAA
CCAATAATGCTGGTCATAGTGGTAGTGATGCTAATAATTTAGCAACTATA
AAACACCTTTTAAAAACTTACCTTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
927
View in model
Transcription unit TU_010 View in model
Empirical formula (pH 7.5) H9884C8956N3693O6471P927
Molecular weight (pH 7.5; Da) 301501.49 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9615500
pI 4.06
 
Comments
Comments prolyl oligopeptidase; a/b-hydrolase fold family enzyme [PUB_0032]; cytosol aminopeptidase V [PUB_0033]; removes N-terminal amino acid, preference proline >> alanine >> other amino acids [PUB_0032]
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Holmquist M. Alpha/Beta-hydrolase fold enzymes: structures, functions and mechanisms. Curr Protein Pept Sci 1, 209-35 (2000). WholeCell: PUB_0032, PubMed: 12369917

  4. Walter R, Simmons WH, Yoshimoto T. Proline specific endo- and exopeptidases. Mol Cell Biochem 30, 111-27 (1980). WholeCell: PUB_0033, PubMed: 6991912

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:10
Last updated 2012-10-01 15:12:40