MG_012 – alpha-L-glutamate ligase

Name
WID MG_012 View in model
Name alpha-L-glutamate ligase View in model
Symbol rimK
Protein product MG_012_MONOMER
Cross references GenBank: AAC71228.1, BioCyc: MG_012, CMR: MG_012, SwissProt: P47258
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 1106916933 MG_009 MG_010 MG_011 MG_012 MG_013 MG_014 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 13569 (nt), Length: 864 (nt), Direction: Reverse, G/C content: 27.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGAAAAAAATAAACGTTGTTTACAATCCAGCATTTAATCCAATTAGCTC
TAAATTAAATCAAACTCAACTTTTAAAAAATGCTAGTGAAGAGTTAGATA
TAGAACTAAAATTCTTTACTAGTTTTGATATTAATACAACTAAAGCAAAA
GCAAATTTACCCTTCATATCCAACAAAATTCTTTTTATGGATAAAAATAT
TGCTTTAGCTAGATGACTAGAAAGCAATGGTTTTGAAGTAATTAACAGTT
CAATTGGAATTAACAATGCAGATAATAAAGGACTTAGTCACGCTATCATT
GCACAATATCCATTCATAAAGCAGATTAAAACACTTTTAGGACCTCAAAA
TTTTGACAGGGAGTGAAATCCAGTAATGCTCGATGTTTTTATTAATCAAA
TAAAACAAAGTATGGAGTTTCCTGTTATTGTTAAAAGTGTTTTTGGTTCT
TTTGGTGATTATGTTTTTTTGTGTTTAGATGAACAAAAATTAAGAAAAAC
TTTAATGTCTTTTAATCAACAAGCAATTGTGCAAAAATACATTACTTGCT
CTAAAGGTGAATCGGTAAGAGTTATTGTTGTGAACAATAAAGTTATAGGT
GCTTTACATACAACTAATAATAGTGATTTTCGTTCTAATCTCAATAAAGG
GGCAAAGGCAGAACGCTTTTTTTTGAATAAGGAACAAGAAAATTTAGCAG
TTAAAATTAGTAAAGTAATGCAACTTTTTTATTGCGGTATTGATTTTTTG
TTTGATCAAGACAGATCATTGATCTTTTGTGAAGTAAATCCTAATGTGCA
ATTAACAAGAAGCTCAATGTATTTAAATACTAATCTTGCAATTGAGCTTT
TAAAAGCAATTTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
864
View in model
Transcription unit TU_005 View in model
Empirical formula (pH 7.5) H9207C8342N3426O6021P864
Molecular weight (pH 7.5; Da) 280553.70 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.4 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9036400
pI 4.04
 
Comments
Comments adds 4 additional Glu residues to the native E. coli Glu-Glu C-terminus of ribosomal protein S6 [PUB_0110]; mutation of the first glutamate residue to lysine blocks rimK activtity [PUB_0110]; M. genitalium ribosomal protein S6 C terminus is GAKP-C';
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:10
Last updated 2012-10-01 15:12:39