MG_010 – DNA primase-related protein

Name
WID MG_010 View in model
Name DNA primase-related protein View in model
Symbol dnaE
Protein product MG_010_MONOMER
Cross references GenBank: AAC71226.1, CMR: MG_010, BioCyc: MG_010, SwissProt: P47256
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 956815225 MG_007 MG_008 MG_009 MG_010 MG_011 MG_012 MG_013 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 12068 (nt), Length: 657 (nt), Direction: Forward, G/C content: 26.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGGATGTTAGAACTGAAAGATTAAACGAATTGTTTTTTGTTTATCATAA
AAACTTAAAAAATCAATCTAAATCTAAATATAGCAGAGCAGTTAATTACT
TAAAAAGGCGTGGATTCAATTTACAAGATTTTTTAAAAGTTGGGGGTGGT
GTTGGTTATTTACAAAATAAAGAATGATTAAATTTACCTTTATACAGTTT
TGATGGTAATTTAATTGGTTTTCTAAACAGAAAAGTTAGTTATAAAAAGG
AATTTTTATATACACCTTTTAATAAACCTCCTTCAAAGAGCGAAGCTTTT
GTAGGACTCAGAGAATTAGTTATTAAAGACAATAGCATATATCTTGTTGA
AGGTGATTTTGACTGGTTAGCTTTTCGCAAAGCAGGTATATTAAATTCTC
TTCCTCTTTGTGGTTTGACTATTTCAAATCAACAAGTTCAATGATTAAAA
CAAAAAAAGATTAAAAAGATTTTTATCTGTTTTGATAATGATTTAGCTGG
AAAGAATGGAGCAAAAAATTTAAAAGAATATCTAACTAAGCAAGGATTTA
TAACAAAAGTTATAGAAATTAAAGCTGCCGCAAAAGACTGAAATGATTTG
TTTTTATTAAACAACTCAAATTGATCAGCGGTTTTAACTAATCAACTTCT
TTTTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
657
View in model
Transcription unit TU_004 View in model
Empirical formula (pH 7.5) H6997C6339N2592O4579P657
Molecular weight (pH 7.5; Da) 213104.51 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.242995 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6907800
pI 4.09
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:10
Last updated 2012-10-01 15:12:39