MG_0002 – MG170 RNA

Name
WID MG_0002 View in model
Name MG170 RNA View in model
Cross references CMR: MG_0002
 
Classification
Type sRNA View in model
 
Structure
Structure 328534333716 MG_271 MG_272 MG_273 MG_274 MG_275 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 331034 (nt), Length: 182 (nt), Direction: Reverse, G/C content: 34.1%, Sequence:
1
51
101
151
TACCTAGCTTTATTTTTTAGAGCTAGGTACCTCATTTCATAAATTAAAGT
GATGGAAGACAACAAGAAATGCTGCCAATGCAAGTGCGAATGCGCTAAGT
GCAACAGCTGCTGTAAAAAGTAAGACAAAATTTTTGTCTAACAACTAAAA
AGCCAGTAACTAAACTGGCTTTTTTTATTTGT
50
100
150
182
View in model
Transcription unit TU_181 View in model
Empirical formula (pH 7.5) H1948C1765N745O1265P182
Molecular weight (pH 7.5; Da) 59473.74 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
442.124 (dimensionless) (Show evidence)
View in model
Half life
89.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
1848500
pI 3.87
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:09
Last updated 2012-10-01 15:12:37