MG_0001 – scRNA, signal recognition particle 4.5S RNA, MCS1

Name
WID MG_0001 View in model
Name scRNA, signal recognition particle 4.5S RNA, MCS1 View in model
Symbol ffs
Synonyms 4.5S RNA, scRNA
Cross references CMR: MG_0001
 
Classification
Type sRNA View in model
 
Structure
Structure 323424328507 MG_266 MG_267 MG_268 MG_269 MG_270 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 325924 (nt), Length: 83 (nt), Direction: Reverse, G/C content: 42.2%, Sequence:
1
51
AGAACCATCACATCATTAGAGTCGAATCATGTCAGGCCAGAAATGGAGCA
GCATTAAGACTTGTCAGTGAGTGTGATGGTTTT
50
83
View in model
Transcription unit TU_178 View in model
Empirical formula (pH 7.5) H892C808N349O578P83
Molecular weight (pH 7.5; Da) 27310.51 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
736.872 (dimensionless) (Show evidence)
View in model
Half life
1200.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
830900
pI 3.84
 
Function
Complex subunit signal recognition particle
[c]: MG_0001 + MG_048_MONOMERMG_0001_048
View in model
 
Comments
Comments Half-live ≫ 10 minutes [PUB_0397]. Half-lives of sRNA span great range, 60 min for housekeeping and regulatory genes [PUB_0398]. Expression 25% that of ribosomes [PUB_0401].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Lee SY, Bailey SC, Apirion D. Small stable RNAs from Escherichia coli: evidence for the existence of new molecules and for a new ribonucleoprotein particle containing 6S RNA. J Bacteriol 133, 1015-23 (1978). WholeCell: PUB_0401, PubMed: 342486

  4. Vogel J, Bartels V, Tang TH, Churakov G, Slagter-Jäger JG, Hüttenhofer A, Wagner EG. RNomics in Escherichia coli detects new sRNA species and indicates parallel transcriptional output in bacteria. Nucleic Acids Res 31, 6435-43 (2003). WholeCell: PUB_0398, PubMed: 14602901

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  6. Winzeler E, Wheeler R, Shapiro L. Transcriptional analysis of the Caulobacter 4.5 S RNA ffs gene and the physiological basis of an ffs mutant with a Ts phenotype. J Mol Biol 272, 665-76 (1997). WholeCell: PUB_0397, PubMed: 9368649

 
Metadata
Created 2012-10-01 15:07:09
Last updated 2012-10-01 15:12:37