MG492 – tRNA (ARG)

Name
WID MG492 View in model
Name tRNA (ARG) View in model
Cross references CMR: MG492, BioCyc: MG492
 
Classification
Type tRNA View in model
 
Structure
Structure 263923269000 MG_218 MG_219 MG_220 MG_221 MG_222 MG_223 MG_491 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 266423 (nt), Length: 77 (nt), Direction: Forward, G/C content: 50.6%, Sequence:
1
51
GTCATCATAGCTCAATAGGACAGAGTATCAGCTTGCGGAGCTGAGGGTTA
CAGGTTCGATTCCTGTTGGTGACGCCA
50
77
View in model
Transcription unit TU_146 View in model
Empirical formula (pH 7.5) H828C750N325O542P77
Molecular weight (pH 7.5; Da) 25451.40 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
269.144 (dimensionless) (Show evidence)
View in model
Half life
45.0 (min) (Show evidence)
View in model
Codons
  • CGC

  • CGT

View in model
Amino acid ARG View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
743700
pI 4.02
 
Comments
Comments Modifications were first compiled for E. coli [PUB_0045, PUB_0055, PUB_0056, PUB_0064, PUB_0065], and then modifications generated by homologous enzymes were mapped onto M. genitalium by sequence alignment. Modification reaction kinetics were compiled from the primary literature (See Note_RNAModification).
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Björk GR, Ericson JU, Gustafsson CE, Hagervall TG, Jönsson YH, Wikström PM. Transfer RNA modification. Annu Rev Biochem 56, 263-87 (1987). WholeCell: PUB_0065, PubMed: 3304135

  3. Björk GR, Huang B, Persson OP, Byström AS. A conserved modified wobble nucleoside (mcm5s2U) in lysyl-tRNA is required for viability in yeast. RNA 13, 1245-55 (2007). WholeCell: PUB_0055, PubMed: 17592039

  4. Cabedo H, Macián F, Villarroya M, Escudero JC, Martínez-Vicente M, Knecht E, Armengod ME. The Escherichia coli trmE (mnmE) gene, involved in tRNA modification, codes for an evolutionarily conserved GTPase with unusual biochemical properties. EMBO J 18, 7063-76 (1999). WholeCell: PUB_0045, PubMed: 10601028

  5. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  6. ... 3 more

  7. Lauhon CT, Erwin WM, Ton GN. Substrate specificity for 4-thiouridine modification in Escherichia coli. J Biol Chem 279, 23022-9 (2004). WholeCell: PUB_0064, PubMed: 15037613

  8. Samuelsson T, Guindy YS, Lustig F, Borén T, Lagerkvist U. Apparent lack of discrimination in the reading of certain codons in Mycoplasma mycoides. Proc Natl Acad Sci U S A 84, 3166-70 (1987). WholeCell: PUB_0056, PubMed: 3554232

  9. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:32
Last updated 2012-10-01 15:13:53